ID: 1197722791_1197722795

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1197722791 1197722795
Species Human (GRCh38) Human (GRCh38)
Location X:129756267-129756289 X:129756292-129756314
Sequence CCAGGGCCTGGCTCAGCCAGGTG GGATTAACAGACGTGTGCTGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 55, 4: 474} {0: 1, 1: 0, 2: 0, 3: 5, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!