ID: 1197756973_1197756983

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1197756973 1197756983
Species Human (GRCh38) Human (GRCh38)
Location X:130002441-130002463 X:130002479-130002501
Sequence CCAGAGAGAGCCAGCAAAAGGCA AGACAGAGGGAGACCGGGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 93, 4: 1171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!