ID: 1197763525_1197763532

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1197763525 1197763532
Species Human (GRCh38) Human (GRCh38)
Location X:130044290-130044312 X:130044329-130044351
Sequence CCTCTGTTGATTAATTGTCTTCA TCCAGCTGGGCAGAAAATGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 233} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!