ID: 1197864987_1197864990

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1197864987 1197864990
Species Human (GRCh38) Human (GRCh38)
Location X:131008123-131008145 X:131008145-131008167
Sequence CCAGGGACAGTAAACACCGTTAC CTCATCTAATTAGCCAGGAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 16, 4: 285}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!