ID: 1197923489_1197923495 |
View in Genome Browser |
Spacer: 10 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1197923489 | 1197923495 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | X:131621477-131621499 | X:131621510-131621532 |
Sequence | CCCCATCCACAAAATAAAAATAG | CCTCTTATAGTGTTGCTGGAAGG |
Strand | - | + |
Off-target summary | {0: 1, 1: 1, 2: 11, 3: 148, 4: 1936} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |