ID: 1197967111_1197967116

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1197967111 1197967116
Species Human (GRCh38) Human (GRCh38)
Location X:132076895-132076917 X:132076921-132076943
Sequence CCTCCCTCCTTTTCCATGTTCTG CTGTCCCTTTCCTTAGTAATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 54, 4: 604} {0: 1, 1: 0, 2: 0, 3: 19, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!