ID: 1197986257_1197986264

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1197986257 1197986264
Species Human (GRCh38) Human (GRCh38)
Location X:132269307-132269329 X:132269359-132269381
Sequence CCTGCTCAAGTTGTTAGCACTGT ATTTTCTAGGCCAGGCACAGTGG
Strand - +
Off-target summary No data {0: 3, 1: 62, 2: 409, 3: 2335, 4: 8562}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!