ID: 1198012481_1198012488

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1198012481 1198012488
Species Human (GRCh38) Human (GRCh38)
Location X:132572424-132572446 X:132572474-132572496
Sequence CCTGAGATATGGAGATCTGATGA CTGTGAATCAGGAGCAACCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 138} {0: 1, 1: 0, 2: 3, 3: 18, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!