ID: 1198078553_1198078560

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1198078553 1198078560
Species Human (GRCh38) Human (GRCh38)
Location X:133217244-133217266 X:133217275-133217297
Sequence CCTCCAAAAGTTCCCTGAGCCAT CGTACGGCTCCAGAGCCTTTGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 3, 3: 16, 4: 202} {0: 2, 1: 0, 2: 2, 3: 3, 4: 29}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!