ID: 1198127719_1198127722

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1198127719 1198127722
Species Human (GRCh38) Human (GRCh38)
Location X:133662712-133662734 X:133662746-133662768
Sequence CCTTTTGCTTTCATCATGTGGAA CCATTGCCAAAGAGAGAAAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 94, 4: 895}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!