ID: 1198177612_1198177624

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1198177612 1198177624
Species Human (GRCh38) Human (GRCh38)
Location X:134172163-134172185 X:134172191-134172213
Sequence CCGCGCGCGGGACCCAGCTCCGG CCCTCGCAGGTGGAGAGCGCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!