ID: 1198189347_1198189353 |
View in Genome Browser |
Spacer: 0 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1198189347 | 1198189353 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | X:134287487-134287509 | X:134287510-134287532 |
| Sequence | CCTGTCTGGAGCAGCTGCTGCAA | AGATGCCAGCTGCAGTGGGGGGG |
| Strand | - | + |
| Off-target summary | {0: 7, 1: 17, 2: 46, 3: 126, 4: 369} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||