ID: 1198205401_1198205415

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1198205401 1198205415
Species Human (GRCh38) Human (GRCh38)
Location X:134460395-134460417 X:134460437-134460459
Sequence CCGGGCCCTGAGGCGCGGGATCC CCGGGCCCAGGGAACCCCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 167} {0: 1, 1: 0, 2: 1, 3: 20, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!