ID: 1198205418_1198205435

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1198205418 1198205435
Species Human (GRCh38) Human (GRCh38)
Location X:134460442-134460464 X:134460489-134460511
Sequence CCCAGGGAACCCCGCAGGCGGGG TTACGTCACGCGAGGGCGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 145} {0: 1, 1: 0, 2: 0, 3: 1, 4: 10}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!