ID: 1198248079_1198248081

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1198248079 1198248081
Species Human (GRCh38) Human (GRCh38)
Location X:134850951-134850973 X:134850989-134851011
Sequence CCATTTTTGGCCAGATACAATAA TGAAATTTATTCATATATTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 210} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!