ID: 1198270319_1198270328

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1198270319 1198270328
Species Human (GRCh38) Human (GRCh38)
Location X:135051136-135051158 X:135051173-135051195
Sequence CCAGGCACACTTAAGCCCTGGCA ACACAAGAGGTCTCTGGGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 142} {0: 1, 1: 0, 2: 2, 3: 22, 4: 249}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!