ID: 1198276639_1198276642

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1198276639 1198276642
Species Human (GRCh38) Human (GRCh38)
Location X:135100282-135100304 X:135100297-135100319
Sequence CCATCCTCCTCATGAGTTTTTAA GTTTTTAAAATGATGTTTGATGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 4, 3: 28, 4: 305} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!