ID: 1198290285_1198290293

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1198290285 1198290293
Species Human (GRCh38) Human (GRCh38)
Location X:135233654-135233676 X:135233697-135233719
Sequence CCCAGTGAGGGATCCCTATCACC CCCTCCACCATGTCTCTAAATGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 3, 4: 73} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!