ID: 1198301622_1198301625

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1198301622 1198301625
Species Human (GRCh38) Human (GRCh38)
Location X:135339177-135339199 X:135339198-135339220
Sequence CCCTCTATCTTCAACAGATAAGA GACTGACTCTTCCTGGCCTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 22, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!