ID: 1198310233_1198310242

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1198310233 1198310242
Species Human (GRCh38) Human (GRCh38)
Location X:135422538-135422560 X:135422553-135422575
Sequence CCCTGGCCCCGGCTGCGGTCTCA CGGTCTCAGCCCGGGGGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 182} {0: 1, 1: 1, 2: 0, 3: 22, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!