ID: 1198315903_1198315905

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1198315903 1198315905
Species Human (GRCh38) Human (GRCh38)
Location X:135465886-135465908 X:135465916-135465938
Sequence CCTAACATTTATATGGAATCACA CAGAATAGCCAAAATTATCCTGG
Strand - +
Off-target summary {0: 2, 1: 79, 2: 537, 3: 1387, 4: 2807} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!