ID: 1198343791_1198343799

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1198343791 1198343799
Species Human (GRCh38) Human (GRCh38)
Location X:135740452-135740474 X:135740494-135740516
Sequence CCCATTCTTTTTGAGACAGGGTT GGAGTGCAGTGGCACGATCTCGG
Strand - +
Off-target summary {0: 2, 1: 3, 2: 49, 3: 361, 4: 1189} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!