ID: 1198363173_1198363177 |
View in Genome Browser |
Spacer: 7 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1198363173 | 1198363177 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | X:135915660-135915682 | X:135915690-135915712 |
Sequence | CCATGCTTCTTCAACATGTGAGG | AAGGTGGCTGACTACAAGTTAGG |
Strand | - | + |
Off-target summary | No data | {0: 1, 1: 1, 2: 11, 3: 64, 4: 280} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |