ID: 1198363173_1198363177

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1198363173 1198363177
Species Human (GRCh38) Human (GRCh38)
Location X:135915660-135915682 X:135915690-135915712
Sequence CCATGCTTCTTCAACATGTGAGG AAGGTGGCTGACTACAAGTTAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 11, 3: 64, 4: 280}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!