ID: 1198370718_1198370738

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1198370718 1198370738
Species Human (GRCh38) Human (GRCh38)
Location X:135986061-135986083 X:135986101-135986123
Sequence CCCTTTTTCCTCCGCACCCCCAG GCCTACCAAGCTCGGGACCCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 12, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!