ID: 1198441367_1198441383

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1198441367 1198441383
Species Human (GRCh38) Human (GRCh38)
Location X:136666612-136666634 X:136666659-136666681
Sequence CCTCAATTTCCAGTGACCTTCCC TTTGGGGAGGGAGGGGTGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 251} {0: 1, 1: 0, 2: 16, 3: 221, 4: 2269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!