ID: 1198444826_1198444829

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1198444826 1198444829
Species Human (GRCh38) Human (GRCh38)
Location X:136702001-136702023 X:136702053-136702075
Sequence CCGGCCTCATTTTTCTTATTCTT AATAATAGCAACAGTGTATTGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 38, 3: 506, 4: 6904} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!