ID: 1198480209_1198480221

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1198480209 1198480221
Species Human (GRCh38) Human (GRCh38)
Location X:137033877-137033899 X:137033922-137033944
Sequence CCTCTCGGGGCTCGGGCGGCTGC GCTGCGGGCGCGGCAGGAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 209} {0: 1, 1: 0, 2: 6, 3: 74, 4: 631}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!