ID: 1198524862_1198524871

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1198524862 1198524871
Species Human (GRCh38) Human (GRCh38)
Location X:137490981-137491003 X:137491004-137491026
Sequence CCTTGCCTCTTCTGTATCCCCCC ACAATACAGAGGATTGAGTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 14, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!