ID: 1198556626_1198556633

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1198556626 1198556633
Species Human (GRCh38) Human (GRCh38)
Location X:137800019-137800041 X:137800066-137800088
Sequence CCTCCTCCATCTCCAGACATTGC TCACCCTGACTGAGAACCACTGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 4, 3: 45, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!