ID: 1198607521_1198607526

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1198607521 1198607526
Species Human (GRCh38) Human (GRCh38)
Location X:138357927-138357949 X:138357963-138357985
Sequence CCATTATAAGGGTACATGGCCAG TACCTATAGTCCCAGCACTTTGG
Strand - +
Off-target summary No data {0: 8, 1: 942, 2: 25782, 3: 205199, 4: 326180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!