ID: 1198607521_1198607535

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1198607521 1198607535
Species Human (GRCh38) Human (GRCh38)
Location X:138357927-138357949 X:138357980-138358002
Sequence CCATTATAAGGGTACATGGCCAG CTTTGGGAGGCTGAGGTGGGAGG
Strand - +
Off-target summary No data {0: 23522, 1: 76482, 2: 160024, 3: 176046, 4: 158971}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!