ID: 1198687667_1198687674

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1198687667 1198687674
Species Human (GRCh38) Human (GRCh38)
Location X:139244715-139244737 X:139244764-139244786
Sequence CCATCAGAAGCTGAAAGAGGCAA TGGAGGAAGTGCAGCCCTGCTGG
Strand - +
Off-target summary {0: 5, 1: 39, 2: 253, 3: 766, 4: 1625} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!