ID: 1198757898_1198757902

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1198757898 1198757902
Species Human (GRCh38) Human (GRCh38)
Location X:140000461-140000483 X:140000497-140000519
Sequence CCAGTATTTTATTGAGGATTTTT CAATCTGACTGAGGGGCATAAGG
Strand - +
Off-target summary {0: 8281, 1: 5080, 2: 2467, 3: 1132, 4: 1140} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!