ID: 1198761231_1198761238

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1198761231 1198761238
Species Human (GRCh38) Human (GRCh38)
Location X:140034677-140034699 X:140034719-140034741
Sequence CCATGAGACATTGTGGCCAGCAA AGGGAAAAACAGAAGAGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 194} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!