ID: 1198761545_1198761561

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1198761545 1198761561
Species Human (GRCh38) Human (GRCh38)
Location X:140038294-140038316 X:140038345-140038367
Sequence CCTCCCCCATTCCCCAGTAGCAC AGGGAGAGGAAAGTGACTGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 40, 4: 415} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!