ID: 1198806915_1198806920

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1198806915 1198806920
Species Human (GRCh38) Human (GRCh38)
Location X:140502603-140502625 X:140502633-140502655
Sequence CCCGTTTTTGGTCGGTTTCAGCG CTTTCCAGCCCCGCCTCGCGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!