ID: 1198816748_1198816752

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1198816748 1198816752
Species Human (GRCh38) Human (GRCh38)
Location X:140599657-140599679 X:140599685-140599707
Sequence CCTACTCTATTTGTGGTGTAGGC AATCTGGACTACATCAGGTCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!