ID: 1198816748_1198816753

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1198816748 1198816753
Species Human (GRCh38) Human (GRCh38)
Location X:140599657-140599679 X:140599697-140599719
Sequence CCTACTCTATTTGTGGTGTAGGC ATCAGGTCTGGTAGCATCTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 4, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!