ID: 1198833465_1198833484

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1198833465 1198833484
Species Human (GRCh38) Human (GRCh38)
Location X:140776490-140776512 X:140776541-140776563
Sequence CCTCTTCCTTCCTTCCTCCCGCC CGCGCGTGACCACCCACTCCGGG
Strand - +
Off-target summary {0: 2, 1: 16, 2: 175, 3: 1062, 4: 4001} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!