ID: 1198887273_1198887282

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1198887273 1198887282
Species Human (GRCh38) Human (GRCh38)
Location X:141353350-141353372 X:141353376-141353398
Sequence CCTTGATCAGGGCCAGGAGGCTG GTGTTTACCACTTGGGGCAGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!