ID: 1198887279_1198887284

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1198887279 1198887284
Species Human (GRCh38) Human (GRCh38)
Location X:141353374-141353396 X:141353392-141353414
Sequence CCGTGTTTACCACTTGGGGCAGG GCAGGGGCATTCATAGCCCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 9, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!