ID: 1198887279_1198887285

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1198887279 1198887285
Species Human (GRCh38) Human (GRCh38)
Location X:141353374-141353396 X:141353398-141353420
Sequence CCGTGTTTACCACTTGGGGCAGG GCATTCATAGCCCTTGGTTTCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!