ID: 1198928010_1198928018

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1198928010 1198928018
Species Human (GRCh38) Human (GRCh38)
Location X:141821507-141821529 X:141821560-141821582
Sequence CCTTCAACTACCTCAAACAATGG GGCCCAAATCCTGGTGGTACTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 3, 3: 20, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!