ID: 1198936414_1198936423

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1198936414 1198936423
Species Human (GRCh38) Human (GRCh38)
Location X:141905358-141905380 X:141905411-141905433
Sequence CCTGTTTTTCTTTCTCATCCTCA GACAAGGATATGCCTACTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 98, 4: 1017} {0: 1, 1: 0, 2: 1, 3: 4, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!