ID: 1198941873_1198941881

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1198941873 1198941881
Species Human (GRCh38) Human (GRCh38)
Location X:141965153-141965175 X:141965189-141965211
Sequence CCGGGTTCCTCCCATGACATGTG CTGTAATTCAGGAGGAGATTTGG
Strand - +
Off-target summary {0: 50, 1: 370, 2: 1057, 3: 2632, 4: 4275} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!