ID: 1198941875_1198941881

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1198941875 1198941881
Species Human (GRCh38) Human (GRCh38)
Location X:141965160-141965182 X:141965189-141965211
Sequence CCTCCCATGACATGTGGCAATTA CTGTAATTCAGGAGGAGATTTGG
Strand - +
Off-target summary {0: 3, 1: 165, 2: 1009, 3: 3216, 4: 6222} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!