ID: 1198942399_1198942405

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1198942399 1198942405
Species Human (GRCh38) Human (GRCh38)
Location X:141971002-141971024 X:141971026-141971048
Sequence CCATCTATCCCATCCCTAGAAGG TTTAAAAATATTTTTCATTATGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 47, 3: 334, 4: 2437}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!