ID: 1198993626_1198993629

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1198993626 1198993629
Species Human (GRCh38) Human (GRCh38)
Location X:142546714-142546736 X:142546748-142546770
Sequence CCAACCTAAGTCTTTTTGCTTAA ACAGGAGAGATTGATTTGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 322} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!