ID: 1198999979_1198999982

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1198999979 1198999982
Species Human (GRCh38) Human (GRCh38)
Location X:142624229-142624251 X:142624256-142624278
Sequence CCAGATCTCAGGATAACTCTCTC TTGCCATGACAACGCCAAAGGGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 168, 3: 1292, 4: 2694} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!