ID: 1199012614_1199012616

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1199012614 1199012616
Species Human (GRCh38) Human (GRCh38)
Location X:142775686-142775708 X:142775727-142775749
Sequence CCTCTCTTCTTCTTTTGGAGTCA ACAGCTCTTTCAGTTTCCCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 3, 3: 15, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!